rs6433033 chr2:168118810 T>G
- Sequence
ttacagactggtaagcaattcctg[T/G]ccagattcttagtcaatgaactgt
- ASB in cell types
- IMR90 (lung fibroblasts) HUVEC-C (HUVEC, umbilical vein endothelial cells) GM19240 (B cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| IMR90 (lung fibroblasts) | 2.65 | n/a | 1.00 | |||
| HUVEC-C (HUVEC, umbilical vein endothelial cells) | 1.70 | -1.64 | 1.00 | |||
| GM19240 (B cells Lymphoblastoid Cell Lines) | -0.26 | 0.54 | 1.00 |
Items per page:
1 – 3 of 3