rs6433232 chr2:170689703 G>A
- Sequence
tgtttcagagaacaggaaacacca[G/A]taattaaaatactgctaatcccga
- ASB for transcription factors
- FOS_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOS_HUMAN | 2.35 | -1.83 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP fasting blood glucose, obesity with early age of onset (age >2), schizophrenia, spine bone mineral density (bmd), tetrology of fallot, transmission distortion