rs6433704 chr2:177983185 T>G
- Sequence
gagatttatttctaaatttagaaa[T/G]ttatttctaatttgtcctcaataa
- ASB in cell types
- bipolar neuron foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| bipolar neuron | -3.85 | 3.90 | 1.00 | |||
| foreskin keratinocyte | n/a | 2.68 | 3.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Breast_Mammary_Tissue, Heart_Left_Ventricle, Nerve_Tibial, Prostate