rs6433880 chr2:181037198 A>C
- Sequence
ggaaacaaacttgtgctgccagca[A/C]atataattatatgtagtacatact
- ASB in cell types
- GM23248
- ASB for transcription factors
- EZH2_HUMAN SP7_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EZH2_HUMAN | 3.33 | -3.67 | 1.00 | n/a | n/a | |||
| SP7_HUMAN | -2.17 | 2.52 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Artery_Tibial, Brain_Cerebellum, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Whole_Blood