rs6434485 chr2:191566265 G>C
- Sequence
ataaaaaaaaaaaaaaaaagaaga[G/C]tgcagaatgccagcaggtccaggg
- ASB in cell types
- GM18951 (B-cells Lymphoblastoid Cell Lines) Peyer's patch
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18951 (B-cells Lymphoblastoid Cell Lines) | 1.51 | -0.70 | 1.00 | |||
| Peyer's patch | -1.47 | 2.05 | 1.00 |
Items per page:
1 – 2 of 2