rs6437009 chr2:231245770 T>C
- Sequence
tctgctgtttgtaatggtgtagta[T/C]gcattttccctgccaagagcagtt
- ASB in cell types
- GM12891 (male B- cells lymphoblastoid cell line) GM12878 (female B-cells lymphoblastoid cell line) GM19240 (B cells Lymphoblastoid Cell Lines) MS-1 (Small cell lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12891 (male B- cells lymphoblastoid cell line) | -1.71 | 2.34 | 1.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 1.69 | 0.13 | 1.06 | |||
| GM19240 (B cells Lymphoblastoid Cell Lines) | -0.14 | 1.94 | 1.00 | |||
| MS-1 (Small cell lung carcinoma) | -0.99 | 1.37 | 1.00 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Spleen, Thyroid