rs6437061 chr2:232320342 A>C
- Sequence
agcgttagttcagtggaaaaaaaa[A/C]caagacaaaaggagttttctttta
- ASB in cell types
- prostate cancer
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| prostate cancer | 2.31 | -2.06 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI waist circumference adjusted for bmi (adjusted for smoking behaviour), waist circumference adjusted for bmi (joint analysis main effects and physical activity interaction), waist circumference adjusted for bmi (joint analysis main effects and smoking interaction), waist circumference adjusted for bmi in active individuals, waist circumference adjusted for bmi in non-smokers, waist circumference adjusted for body mass index
GRASP advanced age-related macular degeneration, fasting blood glucose, fasting insulin, height, hip bone mineral density (bmd), homa-ir, premature ovarian failure