rs6437294 chr2:240143870 T>G
- Sequence
agaacatgctcacacacacaagac[T/G]gtcttggtgggcactggtgggtcc
- ASB in cell types
- foreskin keratinocyte PC9 (lung adenocarcinoma) GM23338
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | n/a | 0.61 | 2.33 | |||
| PC9 (lung adenocarcinoma) | 0.88 | -0.23 | 1.00 | |||
| GM23338 | -0.85 | 1.46 | 1.00 |
Items per page:
1 – 3 of 3