rs6439902 chr3:140220307 T>C
- Sequence
atctcaatcctatatatgtcagta[T/C]tgtgatgtatttggtcactagcct
- ASB in cell types
- GM19099 (female B-cells Lymphoblastoid Cell Lines) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19099 (female B-cells Lymphoblastoid Cell Lines) | -0.49 | 1.99 | 1.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.24 | 0.65 | 1.05 |
Items per page:
1 – 2 of 2