rs6440001 chr3:141367130 T>C
- Sequence
cacagttccaactctttctgagtc[T/C]ggaatctttgagagtgccgtcatg
- ASB in cell types
- TTC-1240 (Rhabdoid tumor of the kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| TTC-1240 (Rhabdoid tumor of the kidney) | 1.05 | 1.07 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), body mass index (bmi), coronary artery disease (cad), cystatin c in serum, height, homa-b, infant head circumference, myopia, rheumatoid arthritis, simpson-angus scale, sporadic creutzfeldt-jakob disease, variant creutzfeldt-jakob disease
GTEx eQTL Esophagus_Mucosa, Muscle_Skeletal, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Testis, Thyroid, Whole_Blood