rs6440052 chr3:141940399 C>T
- Sequence
ggatatgacaaatgctgctctaca[C/T]taaccggattggttgtgcccccac
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HUVEC-C (HUVEC, umbilical vein endothelial cells) | 0.41 | 1.19 | 1.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP age-related hearing impairment, atp1b3 expression in lymphocytes tissue, chronic kidney disease, cystatin c in serum, infant head circumference, neuroticism, rheumatoid arthritis, salmonella-induced pyroptosis, serum creatinine, serum creatinine estimated glomerular filtration rate (egfr), serum cystatin c estimated glomerular filtration rate (egfr), sporadic creutzfeldt-jakob disease, tetrology of fallot