rs6440072 chr3:142213514 G>A
- Sequence
cccagcagtagggtgcttatcaca[G/A]aatgtacttacttgttccacgtaa
- ASB in cell types
- LHSAR (prostate epithelial cells) LNCaP (prostate carcinoma) T47D (invasive ductal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LHSAR (prostate epithelial cells) | 2.09 | n/a | 3.00 | |||
| LNCaP (prostate carcinoma) | 0.79 | -0.10 | 1.40 | |||
| T47D (invasive ductal carcinoma) | 1.81 | -0.64 | 2.00 |
Items per page:
1 – 3 of 3