rs6440193 chr3:143775704 C>A
- Sequence
tgacacttgccccctcctgtttaa[C/A]atccattttaatataatccacact
- ASB in cell types
- LUHMES (lund human mesencephalic cells) neural cell GM19238 (female B-cells lymphoblastoid cell lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LUHMES (lund human mesencephalic cells) | 0.19 | 2.54 | 1.00 | |||
| neural cell | -0.05 | 0.85 | 1.00 | |||
| GM19238 (female B-cells lymphoblastoid cell lines) | -0.53 | 0.54 | 1.00 |
Items per page:
1 – 3 of 3