rs6440528 chr3:148088186 G>A
- Sequence
cactcgcccaggatcgcactcatg[G/A]ccacaacaaagatgatggcttttc
- ASB in cell types
- SEM (childhood B acute lymphoblastic leukemia)
- ASB for transcription factors
- RUNX2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RUNX2_HUMAN | -2.46 | 2.87 | 1.00 | 2.07 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
