rs6440618 chr3:149508468 C>T
- Sequence
cacaagcctatgatatagaaacaa[C/T]gataagccccattttgcataaaag
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells)
- ASB for transcription factors
- NOTC1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NOTC1_HUMAN | n/a | 2.60 | 3.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP comorbid depressive syndrome and alcohol dependence, diabetic retinopathy in type 2 diabetes mellitus, fasting insulin, homa-b, homa-ir, suicide attempts in bipolar disorder, suicide attempts in bipolar disorder (females)