rs6440836 chr3:152961631 G>A
- Sequence
aatggaagtagtgttgatgctttc[G/A]ctatagtaccattccagccttatt
- ASB in cell types
- foreskin keratinocyte H929 (plasma cell myeloma)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.58 | 1.13 | 1.14 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder, chronic kidney disease, hdl cholesterol, infant head circumference, irritible bowel syndrome, neuroticism, prop taste detection threshold, salmonella-induced pyroptosis