rs6442380 chr3:13386498 G>T
- Sequence
aagagaaagagatgttttaaacat[G/T]ggaatagggaagttaagaggaaag
- ASB in cell types
- TALL1 (T-Acute Lymphoblastic Leukemia) MDM(monocyte derived macrophages)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| TALL1 (T-Acute Lymphoblastic Leukemia) | -1.83 | 2.78 | 2.00 | |||
| MDM(monocyte derived macrophages) | -1.44 | 2.53 | 2.25 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Esophagus_Mucosa, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg