rs6442577 chr3:16060655 T>C
- Sequence
gcaccccagcttccaccacataga[T/C]gctcacctctcctgccccgtgatg
- ASB in cell types
- HepG2 (hepatoblastoma) heart left ventricle foreskin keratinocyte gastroesophageal sphincter
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 0.55 | 0.89 | 1.12 | |||
| heart left ventricle | 2.74 | n/a | 1.00 | |||
| foreskin keratinocyte | 0.37 | 2.53 | 2.17 | |||
| gastroesophageal sphincter | 2.28 | -2.03 | 1.00 |
Items per page:
1 – 4 of 4