rs6443222 chr3:9121583 C>T
- Sequence
caccctaattagactttcatagtg[C/T]gtcaggcagcctgcatggccgggc
- ASB in cell types
- Kelly (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| Kelly (neuroblastoma) | 2.15 | -1.95 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP decrease in fev1 (in asthmatic participants >=30 years old), diabetic retinopathy in type 2 diabetes mellitus, lp-pla2 mass, lung function, forced expiratory volume in 1 second (fev1) percent predicted (in asthmatic participants), maternal transmission distortion, triglycerides