rs6443265 chr3:9782967 C>T
- Sequence
tcctcaagatgtcacctataccct[C/T]gtgatcaatgcagaacaagatgga
- ASB in cell types
- GM19238 (female B-cells lymphoblastoid cell lines) foreskin keratinocyte GM18526 (B – cells Lymphoblastoid Cell Lines) spleen
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.21 | 1.40 | 1.21 | n/a | No Hit | |||
| STAG1_HUMAN | -0.77 | 2.07 | 1.07 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP acute lung injury following major trauma, obesity with early age of onset (age >2), total cholesterol
GTEx eQTL Adipose_Subcutaneous, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Muscularis, Heart_Left_Ventricle, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood