rs6443449 chr3:177359830 T>C
- Sequence
ggggggaggcattagttatttctg[T/C]ctgaggagtttttgaccaaacgta
- ASB in cell types
- primary B-CLL cells MM1.S (plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| primary B-CLL cells | n/a | 2.44 | 3.00 | |||
| MM1.S (plasma cell myeloma) | 1.25 | 0.45 | 2.08 |
Items per page:
1 – 2 of 2