rs6444106 chr3:186093706 G>A
- Sequence
agtgtggggggcactccaaactcc[G/A]gggggagctcaagacttgccctac
- ASB in cell types
- GM18951 (B-cells Lymphoblastoid Cell Lines) GM19193 (female B-cells Lymphoblastoid Cell Lines) GM10847 (female B-cells Lymphoblastoid Cell Lines) GM02255 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | -0.69 | 3.17 | 2.15 | 2.77 | Concordant | |||
| STAG1_HUMAN | -3.02 | 3.05 | 3.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP birth weight, body mass index (bmi), hdl cholesterol, obesity with early age of onset (age >2), serum creatinine, stabilized warfarin dose, years of education