rs6445607 chr3:53843122 G>T
- Sequence
ggatcaggcaaagaagcaaaggtc[G/T]gaataacaatgacagaatctgggg
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) KATOIII (signet ring cell gastric adenocarcinoma)
- ASB for transcription factors
- HNF4A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HNF4A_HUMAN | 2.37 | -1.08 | 1.50 | -0.03 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP 2 hour glucose, adiponectin levels, college completion, obesity with early age of onset (age >2), refractive error, rheumatoid arthritis, years of education
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Brain_Amygdala, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Liver, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Stomach, Testis, Thyroid