rs6445984 chr3:58474637 C>T
- Sequence
gggtgaagtgctctttagtcccta[C/T]aggaggaagtgattggcttttgga
- ASB in cell types
- macrophages form periferal blood monocytes from periferal blood monocyte-derived dendritic cells
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| macrophages form periferal blood | -2.74 | 1.57 | 2.00 | |||
| monocytes from periferal blood | 1.34 | -0.60 | 1.00 | |||
| monocyte-derived dendritic cells | 1.38 | 0.90 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, hdl cholesterol, ldl cholesterol, mitral annular calcium, refractive error, total cholesterol
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Nucleus_accumbens_basal_ganglia, Cells_Cultured_fibroblasts, Colon_Sigmoid, Liver, Nerve_Tibial, Whole_Blood