rs6446525 chr4:6720516 G>A
- Sequence
aactaaagccttatatcctgccac[G/A]gtcactgggcactggaaattcaga
- ASB in cell types
- erythroid cells HUVEC-C (HUVEC, umbilical vein endothelial cells) PC9 (lung adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| erythroid cells | 2.60 | n/a | 1.50 | |||
| HUVEC-C (HUVEC, umbilical vein endothelial cells) | 1.55 | n/a | 1.00 | |||
| PC9 (lung adenocarcinoma) | 1.14 | -0.67 | 2.00 |
Items per page:
1 – 3 of 3