rs6448021 chr4:21135115 G>A
- Sequence
ggatcacttaagacagtctgcaga[G/A]gtctcacaaaatggacattttaga
- ASB in cell types
- H929 (plasma cell myeloma) RH4 (alveolar rhabdomyosarcoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| H929 (plasma cell myeloma) | -1.62 | 2.01 | 1.00 | |||
| RH4 (alveolar rhabdomyosarcoma) | 1.94 | -0.99 | 1.00 |
Items per page:
1 – 2 of 2