rs6448272 chr4:24473124 G>T
- Sequence
ccagaccttttgcagcccgcggcc[G/T]gccggccgccttctccgacctcct
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) MCF7L-P(immortalized breast epithelial cell line) transverse colon pancreas
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.36 | 0.99 | 1.37 | 3.22 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
