rs6448273 chr4:24473333 G>A
- Sequence
aacctcctggcaagccttccttcc[G/A]ccctgtttgaagattttttttttt
- ASB in cell types
- H929 (plasma cell myeloma) tibial nerve
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| H929 (plasma cell myeloma) | 2.42 | -2.08 | 1.00 | |||
| tibial nerve | -1.17 | 1.74 | 1.00 |
Items per page:
1 – 2 of 2