rs6450418 chr5:57157580 G>T
- Sequence
actgaataaactgaagaatcgtac[G/T]tccttttatgggaaactttaccaa
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- SRF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SRF_HUMAN | -2.11 | 2.60 | 1.00 | 2.38 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP childhood acute lymphoblastic leukemia, hdl cholesterol, ldl cholesterol change with statins, salmonella-induced pyroptosis