rs6451118 chr5:34465584 G>A
- Sequence
gacttaggcaaatgattatcaata[G/A]tggcaatgaagtcagccagattag
- ASB in cell types
- GM17942 (lymphoblastoid cell) neural cell MS-1 (Small cell lung carcinoma) GM12890 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.94 | 0.39 | 1.35 | n/a | No Hit | |||
| RAD21_HUMAN | 3.32 | -3.46 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2