rs6451494 chr5:40411189 T>C
- Sequence
gggagtttctgtttcaatcaaaga[T/C]atatttggctcatatttccacctc
- ASB in cell types
- monocyte-derived macrophages from peripheral blood HUVEC-C (HUVEC, umbilical vein endothelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| monocyte-derived macrophages from peripheral blood | -0.95 | 3.16 | 2.50 | |||
| HUVEC-C (HUVEC, umbilical vein endothelial cells) | -0.02 | 1.70 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, college completion, height, ldl cholesterol, major depressive disorder (broad definition), major depressive disorder (broad definition) (females), microalbuminuria, obesity with early age of onset (age >2), triglycerides, type 2 diabetes