rs6456514 chr6:22956398 T>C
- Sequence
caaccaggaccccaaataaagcag[T/C]gcacgtctgtggaatttatgagca
- ASB in cell types
- neural cell
- ASB for transcription factors
- RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RAD21_HUMAN | -1.99 | 2.39 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP college completion, major depressive disorder, rheumatoid arthritis, combined control dataset, gender differentiated, serum creatinine, total cholesterol change with statins