rs6456625 chr6:24646276 C>T
- Sequence
agggatgtggggcgcggcagccgc[C/T]cctgcccagctcccctgctcagct
- ASB in cell types
- UCLA1 hESCs ESO-26 (Gastroesophageal junction adenocarcinoma) MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- AP2C_HUMAN KLF5_HUMAN RFX1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| AP2C_HUMAN | 3.44 | -3.79 | 1.00 | n/a | No Hit | |||
| KLF5_HUMAN | 2.89 | -2.78 | 1.00 | -2.73 | Concordant | |||
| RFX1_HUMAN | 0.64 | -0.54 | 2.08 | -1.35 | Weak Concordant |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GTEx eQTL Artery_Aorta, Brain_Caudate_basal_ganglia, Brain_Cortex, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Esophagus_Mucosa, Heart_Atrial_Appendage, Lung, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood