rs6457401 chr6:31367075 G>T
- Sequence
agaagcagcgcagcagcgccacct[G/T]gtggtcgatgcgcttcctttgcag
- ASB in cell types
- WA01 (H1, human embryonic stem cells) GM12878 (female B-cells lymphoblastoid cell line) lymphoblastoid cells HepG2 (hepatoblastoma)
- ASB for transcription factors
- CTCF_HUMAN RAD21_HUMAN STAT1_HUMAN TADBP_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.50 | 0.46 | 1.35 | -4.55 | Concordant | |||
| RAD21_HUMAN | 2.19 | 0.20 | 1.84 | n/a | n/a | |||
| STAT1_HUMAN | 1.62 | -3.78 | 1.67 | n/a | No Hit | |||
| TADBP_HUMAN | 2.90 | -2.63 | 1.00 | n/a | n/a | |||
| IRF2_HUMAN | 2.90 | -5.13 | 2.00 | n/a | No Hit |
Items per page:
1 – 5 of 6
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), aortic valve calcium, college completion, cystatin c in serum, diabetic retinopathy in type 2 diabetes mellitus, height, infant head circumference, ldl cholesterol, prop taste detection threshold, rheumatoid arthritis, total cholesterol, years of education
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Amygdala, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Brain_Spinal_cord_cervical_c-1, Brain_Substantia_nigra, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Kidney_Cortex, Liver, Lung, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Ovary, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid, Uterus, Vagina, Whole_Blood