rs6458555 chr6:47309833 G>A
- Sequence
ctgggcgcgagagagcaaaggaac[G/A]acttcccatagcgaagcttccagc
- ASB in cell types
- K562 (myelogenous leukemia) HCC1806(Squamous cell breast carcinoma, acantholytic variant) GBM39 (Human brain tumor)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.23 | 1.01 | 2.97 | |||
| HCC1806(Squamous cell breast carcinoma, acantholytic variant) | 1.71 | -0.64 | 2.00 | |||
| GBM39 (Human brain tumor) | 0.18 | 2.31 | 2.00 |
Items per page:
1 – 3 of 3