rs6459754 chr7:157320666 C>G
- Sequence
ctggtctggaactcctgacctcat[C/G]agctgcccgccttggcctcccaaa
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.39 | -0.04 | 1.50 |
Items per page:
1 – 1 of 1