rs6461249 chr7:16398809 A>C
- Sequence
ctgacacgtgattaacatgattga[A/C]acgtgaccaatacgtttgacacgt
- ASB in cell types
- A549 (lung carcinoma) neural cell HCASMC (Human coronary artery smooth muscle cells)
- ASB for transcription factors
- USF2_HUMAN EP300_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| USF2_HUMAN | n/a | 2.35 | 2.00 | 6.27 | Concordant | |||
| EP300_HUMAN | 1.03 | 0.92 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Artery_Tibial, Brain_Caudate_basal_ganglia, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid