rs6462280 chr7:31488771 T>A
- Sequence
ctccaaggagcccgggtatcattg[T/A]agtccatgtcaatggcgccccctg
- ASB in cell types
- MDA-MB-231p27CK-DD (breast cancer cells, phosphimimetic p27 cell line) ID00015 (lymphoblastoid cell)
- ASB for transcription factors
- JUN_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| JUN_HUMAN | 0.38 | 1.78 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1