rs6463008 chr7:41134327 T>C
- Sequence
tgggacatttgaaggtcacagtca[T/C]gcaaatgcaaccaagatccctggc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- ARNT_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ARNT_HUMAN | -2.85 | 2.92 | 1.00 | 6.25 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP birth weight, cystatin c in serum, fasting blood glucose, rheumatoid arthritis, total cholesterol