rs6463437 chr7:47763237 T>C
- Sequence
tcctgctctcatctcatagccagc[T/C]gatcagtctgttcaccctccacct
- ASB in cell types
- HepG2 (hepatoblastoma) LHSAR (prostate epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 0.78 | 0.41 | 1.10 | |||
| LHSAR (prostate epithelial cells) | 1.57 | -0.29 | 1.50 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Transverse, Liver, Minor_Salivary_Gland, Pituitary, Small_Intestine_Terminal_Ileum, Spleen