rs6463440 chr7:47763331 A>C
- Sequence
attctaccacctggggagggcaga[A/C]ctgggacagacttctttcattttc
- ASB in cell types
- HepG2 (hepatoblastoma) primary B-CLL cells LHSAR (prostate epithelial cells)
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 1.53 | -0.07 | 1.92 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Transverse, Liver, Minor_Salivary_Gland, Pituitary, Small_Intestine_Terminal_Ileum, Spleen