rs6463471 chr7:48139654 A>C
- Sequence
gggcgctgcccaccaagggtccca[A/C]gttgaaaaggaaaagagagggaga
- ASB in cell types
- GM19099 (female B-cells Lymphoblastoid Cell Lines) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19099 (female B-cells Lymphoblastoid Cell Lines) | 1.51 | 2.66 | 1.00 | |||
| foreskin keratinocyte | 1.49 | -0.33 | 2.17 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Muscularis, Lung, Muscle_Skeletal, Testis