rs6464102 chr7:150781217 T>G
- Sequence
tagaggatttcacaacatctccaa[T/G]tgcaaaagttctcccagctcacac
- ASB in cell types
- MOLM-13(acute monocytic leukemia(AML), Homo sapiens) MOLM14 (Adult acute myeloid leukemia)
- ASB for transcription factors
- SMCA4_HUMAN CDK8_HUMAN CEBPA_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMCA4_HUMAN | 2.64 | -2.70 | 1.17 | n/a | n/a | |||
| CDK8_HUMAN | 2.36 | -2.38 | 1.00 | n/a | n/a | |||
| CEBPA_HUMAN | 1.85 | -3.10 | 1.50 | -5.11 | Concordant |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Thyroid, Whole_Blood