rs6464178 chr7:151856671 A>G
- Sequence
tgaaagacgttaagtctggcaccc[A/G]caccgaatataactcagtgaatgc
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) MCF7L-P(immortalized breast epithelial cell line) breast tumor
- ASB for transcription factors
- ESR1_HUMAN NCOA3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 1.66 | 0.83 | 2.13 | n/a | No Hit | |||
| NCOA3_HUMAN | 2.02 | n/a | 3.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP fasting blood glucose, obesity with early age of onset (age >2), total cholesterol change with statins