rs6465508 chr7:96498043 G>A
- Sequence
aaaatttaatgaattttaaacgtg[G/A]caaggtgccaggccctgcgctgag
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- NFIC_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NFIC_HUMAN | 3.85 | -4.19 | 1.00 | -4.68 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP autism, femoral neck bone mineral density (bmd), femoral neck bone mineral density (bmd) (females), femoral neck bone mineral density (bmd) (males), ldl cholesterol, lp-pla2 mass, lumbar spine bone mineral density (bmd), lumbar spine bone mineral density (bmd) (females), lumbar spine bone mineral density (bmd) (males)