rs6465657 chr7:98187015 C>T
- Sequence
aatatctggtacgtattggcttac[C/T]gttttattagtcatttctttggca
- ASB in cell types
- EOL-1 (Acute myeloid leukemia)
- ASB for transcription factors
- SMRC1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMRC1_HUMAN | 2.69 | -2.48 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP asthma, prostate cancer, prostate cancer (advanced prostate cancer), salmonella-induced pyroptosis, triglycerides
PheWAS abnormal reflex, adverse effects of hormones and synthetic substitutes, age-related macular degeneration, aphakia and other disorders of lens, aphasia/speech disturbance, atrial fibrillation, atrial fibrillation & flutter, benign neoplasm of brain and other parts of nervous system, benign neoplasm of other parts of digestive system, candidiasis, cardiac defibrillator in situ, cholecystitis without cholelithiasis, cholelithiasis and cholecystitis, chronic laryngitis, complex regional/central pain syndrome, complication of amputation stump, diabetic retinopathy, dyspareunia, dysphagia, hypertensive heart disease, hypopotassemia, hypotension, inguinal hernia, lump or mass in breast, macular degeneration, mitral valve stenosis and/or aortic valve stenosis, muscle/tendon sprain, nasal polyps, open wound of ear, open wound of eye or eyelid, open wound of lip and mouth, oral aphthae, osteoarthrosis, localized, secondary, other conditions of brain, other congenital anomalies of skin, other disorders of metabolism, other endocrine disorders, other specified diseases of the salivary glands, other specified disorders of liver, other specified erythematous conditions, ovarian cancer, paralytic strabismus, peripheral retinal degenerations, poisoning by other anti-infectives, raynauds syndrome, secondary malignancy of brain/spine, sensorineural hearing loss, sulfonamides, type 1 diabetic neuropathy, type 1 diabetic retinopathy, urinary obstruction, viral infection, vitamin b-complex deficiencies
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Amygdala, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Brain_Spinal_cord_cervical_c-1, Brain_Substantia_nigra, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Ovary, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Thyroid, Uterus, Whole_Blood