rs6466099 chr7:106283030 T>C
- Sequence
taagacttaaatgtgactgtggaa[T/C]acacaatctattttagcatactgc
- ASB in cell types
- K562 (myelogenous leukemia) MS-1 (Small cell lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.47 | 0.01 | 1.46 | |||
| MS-1 (Small cell lung carcinoma) | -1.81 | 2.20 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Cerebellar_Hemisphere, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Heart_Left_Ventricle