rs6466122 chr7:106553821 T>C
- Sequence
tgaactctgtctaccactgcactt[T/C]gatgaggtcctgctcagtacatag
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- KLF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| KLF1_HUMAN | -2.56 | 2.48 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP childhood acute lymphoblastic leukemia, major depressive disorder, simpson-angus scale, waist hip ratio