rs6469036 chr8:106081149 T>C
- Sequence
gttttcaacgacaaaactttatcc[T/C]gcacaatttaaaaaaggattgaag
- ASB in cell types
- MS-1 (Small cell lung carcinoma) 22RV1 (prostate carcinoma) LUHMES (lund human mesencephalic cells) SK-N-AS (neuroblastoma)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.74 | 0.13 | 1.57 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), fasting insulin, homa-b, homa-ir, major depressive disorder (broad definition), major depressive disorder (broad definition) (females), parkinsons disease, systolic blood pressure (sbp)