rs6469037 chr8:106081195 G>A
- Sequence
aagcagcctgggacccctagtgga[G/A]aagcagtgtagtacgcggctcaaa
- ASB in cell types
- RWPE2 MS-1 (Small cell lung carcinoma) Kelly (neuroblastoma) 22RV1 (prostate carcinoma)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.52 | 0.21 | 1.51 | -0.07 | Weak Concordant | |||
| STAG1_HUMAN | 1.06 | -0.14 | 1.93 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
